What is biological evolution?

Question 1

What is biological evolution?

the development of traits that organisms need in order to become more complex

gene changes in populations over many generations

the change that occurs in individuals as they try to survive in their environment

the steps by which the first life was created on earth from random molecules

Question 2

Which of the following BEST describes why the process of evolution is easier to study in fruit flies than in birds?

Fruit flies have a much shorter generation time than birds.

Fruit flies are smaller than birds.

Fruit flies have a simpler diet than birds.

Fruit flies do not live as long as birds.

Question 3

Which of the following groupings is the MOST appropriate according to the classification system developed by Linnaeus?

Group 1: whale, giant fruit bat, giant walking stick (an insect); Group 2: penguin, ostrich, human; Group 3: hummingbird, bee, water strider bug

Group 1: penguin, ostrich, hummingbird; Group 2: water strider bug, giant walking stick (an insect); Group 3: whale, human, giant fruit bat

Group 1: hummingbird, ostrich, bee; Group 2: whale, human, penguin; Group 3: giant walking stick (an insect), water strider bug, giant fruit bat

Group 1: penguin, water strider bug, whale; Group 2: ostrich, giant walking stick (an insect), human; Group 3: hummingbird, bee, giant fruit bat

Question 4

Polar bears from the Arctic do not produce offspring with the speckled bear of South America due to:

temporal isolation.

gamete incompatibility.

behavioral isolation.

spatial isolation.

Question 5

Which of the following statements BEST describes the current knowledge about Earth’s biodiversity?

It is relatively common for scientists to discover new or fossil organisms that are completely different from other organisms.

Most species that have existed on Earth are alive today.

There is uncertainty about the diversity within various species.

Scientists generally agree that most species have been identified.

Question 6

Put the following in order of most inclusive to specific.

Species

Domain

Kingdom

Phyla

Genus

uestion 7

Match the following terms to the definition or example. Not every definition will be used.

Animalia

Bacteria

Viruses

Protista

Fungi

A.

nonliving microbes

B.

most diverse kingdom

C.

eukaryotic, multicellular organisms such as mushrooms

D.

eukaryotic, multicellular organisms such as mammals

E.

prokaryotes such as E. coli

F.

eukaryotic, multicellular organisms that make their own food

Question 8

Match the following terms to the definition or example. Not every definition will be used.

Diatoms

Cnidaria

Tapeworm

Earthworm

Arthropods

Vertebrates

Plants

Algae

Yeast

Mold

A.

Only protists that produce their own food

B.

Parasitic flatworms

C.

Single cells that produce a glass shell

D.

Provide drugs like aspirin and digitali

E.

Animals without backbones

F.

One of the most commercially important fungal forms

G.

Produces the flavor of cheese

H.

Jellyfish and corals

I.

Shrimp, insects, crabs, and spiders

J.

Segmented worms

K.

Animals with backbones

Question 9

Consider what you have learned about natural selection and mutation concerning health issues like TB and head lice, and apply it to pesticide use and farming. Explain what is meant by a “pesticide treadmill” and why it is a concern to farmers and consumers.

Your response should be at least 200 words in length.

What is the key to the recognition of codominance?

Question 5

What is the key to the recognition of codominance?

A- The alleles affect more than one trait.
B- The phenotype of the heterozygote falls between the phenotypes of the homozygotes.
C- The heterozygote expresses the phenotype of both homozygotes.
D- The trait exhibits a continuous distribution.
E- The dominant allele is not always expressed.

Question 22

Answer the next questions using the pedigree below. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing.

What would be the genotype of individual number 1?

A- None of the alleles can be determined
B- D_
C- dd
D- Dd
E- DD

Question 25

Answer the question using the pedigree above. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing. Given that individual #4 and an another individual with genotype Dd are married and want to have children. What is the probability that they have a deaf girl?

A- 0%
B- Cannot be determined from the data
C- 50%
D- 25%
E- 12.5%

Question 26

My wife and I had three girls in a row, Amber, Melissa, and Camila and we recently had a little baby boy (so 3:1 ratio girls to boys). What is the chance that our next child (assume we have not determined the gender) will be male?

A- 25%
B- 33%
C- 67%
D- 50%
E- 75%

Question 30

Given the template DNA strand TACACCTCCCTACTACTCCCGGGATC, and that the string of bases CTACTACT represents an intron region. What is the mRNA processed transcript?

Ans:

Question 33

Based on the phylogenetic tree below, which of the following is most correct?

A- HIV is not related to SIV because Humans did not evolve from chimps
B- HIV evolved multiple times from SIV
C- Since humans are more evolved than chimps, HIV is more evolved than SIV
D- HIV M evolved from HIV O

Question 38

The image below shows evidence from a RFLP analysis from your DNA forensics lab. The defendant testified that the blood on his clothes was his own. What statement below best fits this testimony.

A- He has a valid point because some of the lines seem to match up.
B- It could have been anyone’s blood.
C- He is telling the truth because he is under oath
D- The pattern clearly shows that the blood matches the victims blood
E- There is no way to tell if the blood really is his because it had already dried

Question 41

What is the approximate probability of someone else having the same STR Profile as the one in this figure:

Use the table below to calculate the probability.
Locus Allele Frequency
D3S1358 12 0.015
D3S1358 13 0.015
D3S1358 14 0.1341
D3S1358 15 0.2896
D3S1358 16 0.2287
D3S1358 17 0.1616
D3S1358 18 0.1616
D3S1358 19 0.0152

VWA 12 0.015
VWA 14 0.1311
VWA 15 0.1189
VWA 16 0.186
VWA 17 0.2774
VWA 18 0.189
VWA 19 0.0884
VWA 20 0.015

FGA 18 0.015
FGA 19 0.061
FGA 20 0.125
FGA 21 0.1799
FGA 22 0.2287
FGA 23 0.1311
FGA 24 0.1463
FGA 25 0.0945
FGA 26 0.0183
FGA 27 0.015

A- 39 out of 10,000
B- 12 out of 1000
C- 12 out of a billion
D- 39 out of 1,000,000 people

Question 3

What is the difference between discovery science and hypothesis-driven science?

A- Discovery science involves predictions about outcomes, whereas hypothesis-driven science involves tentative answers to specific questions.
B- Discovery science is based on deductive reasoning, whereas hypothesis-driven science is based on inductive reasoning.
C- Discovery science “discovers” new knowledge, whereas hypothesis-driven science does not.
D- There is no difference between them.
E- Discovery science is mostly about describing nature, whereas hypothesis-driven science tries to explain nature.

Question 4

Aside from Natural selection, Darwin was the first biologist to propose:

A- Mutations in the genes can lead to new variation
B- genetic inheritance, stonger genes in parents lead to stronger genes in the offspring
C- Tree like structure to describe evolution
D- Darwin did not propose anything new aside from natural selection.
E- The evolution of species over time

Question 6

Which of these would Darwin not agree with:

A- The idea that individuals striving to survive leads to better adapted species
B- Evolution via natural selection requires long amounts of time
C- Common ancestry for all of life
D- Significant weight should be given to geology and fossils as evidence of evolution

Question 8

Natural selection always results in ______.

A- an increase in the size of a population
B- increased genetic variation
C- offspring better adapted to a future environment
D- a decrease in the size of a population
E- offspring better adapted to their parents’ environment than were their parents

Question 11

Which of the following is a characteristic of a non-trivial organization system?

A- Only experts in the field would be able to understand it
B- You get more out of it than what you put in it.
C- Tradition trumps new evidence
D- Organized alphabetically
Question 15

For the following questions, determine the ones that can be addressed by Science.

A- How old is the Earth?
B- What morphological characteristics were likely present in the common ancestor of humans and chimps?
C- Why was the Earth created?
D- How does coffee affect ulcers?
E- Are humans most closely related to chimpanzees?

Question 24

Identify each scenario as either a pre-zygotic or post-zygotic barrier to reproduction:

A- Populations never come into contact with each other
B- Offspring fail to reproduce
C- Male and female gametes fail to unite in fertilization.
D- Mating behaviors are not recognized by different organisms
E- Embryos are inviable and do not survive more than a few days
F- Genitalia structures are far too different to allow successful copulation

Question 25

Match the following species concept with one of its disadvantages.

A- Biological species concept
B- Phylogenetic species concept
C- Morphological species concept

Question 26

Which of the following are evidences that evolution has occurred (Mark all that apply): Choose at least one answer.
A- All of the different varieties of dogs that were artificially selected
B- Relatively young earth – less than 10 thousand years.
C- The fossil record
D- Adaptations acquired during life passed on to offspring
E- ack of homology among organisms
F- Marsupial radiation
G- All organisms share the same four DNA nucleotides (A T G C)
H- modern interpretation of the bible
I- Existence of vestigial organs
J- Humans evolving from modern day chimpanzee

Question 28

Mark all that apply: Which of the following is the equivalent to branching points on phylogenetic trees?

A- Speciation events
B- Nodes
C- Branches
D- Common ancestors
E- Internodes

Question 25

Which of the following best describes an enzyme?

A- They lower the amount of energy present in the substrate.
B- They lower the energy of activation of a reaction by binding the substrate.
C- They raise the energy of activation of a reaction by binding the substrate.
D- They heat up the reactants so that reactions occur at a greater speed.

Question 35

A pair of sex chromosomes found in a human male is most like

A- identical twins.
B- a pair of blue jeans.
C- a bride and groom.
D- a knife, fork, and spoon.

Question 46

What are the three main ingredients in photosynthesis?

A- Nitrogen
B- Carbon dioxide
C- Simple sugars
D- Oxygen
E- Light
F- ATP
G- Water

You are investigating a single-celled eukaryotic plant cell and the bacteria that live inside it. What organelles will you observe in both organisms? Give a specific explanation for your answer

1.) You are investigating a single-celled eukaryotic plant cell and the bacteria that live inside it. What organelles will you observe in both organisms? Give a specific explanation for your answer.

2.) Imagine that certain warblers exhibit mating behavior that seperates them from another group of warblers: one group mates and lay eggs only on apple trees, and the other group mates and lay eggs only on walnut trees. How could you design an experiment to test if these are diffrent species or still the same species? Be sure to state your hypothesis, the independent and dependednt variable, and a control in your desigh.

3.) Lithops are succulent plants that resembel stones. Describe four of the characteristics of life that distinguish these plants from the dead stones they mimic.

What is the importance of Prochlorococcus for life on the planet Earth, both historically and in the present day?

What is the importance of Prochlorococcus for life on the planet Earth, both historically and in the present day?

In your primary post, please write a response of at least 125 words to one (1) of the following three (3) bulleted options. In addition, please make a substantive reply to a fellow student on any topic.

Discussion Topic 1. The phytoplankton that brought Earth to life. Review the video (Johnson, 2014) about the “phytoplankton that brought Earth to life” from the link given below, or from the link in the Instructor’s Insights area. In this clip, which is under 5 minutes in length, Penny Chisholm discusses a tiny phytoplankton called Prochlorococcus. Based on that video, please address the following:

(a) What is the importance of Prochlorococcus for life on the planet Earth, both historically and in the present day?

(b) Explain what the known geographic variations in Prochlorococcus tell us about relationships between organisms and their environments.

Discussion Topic 2. Characteristics of ATP. If you choose this topic for your primary post, you must base your post on the instructor’s video about ATP (Cox, 2015). The video can be found in the Instructor Insights area.

(a) Describe two or more characteristics of ATP, covered in the video.

(b) Explain how these characteristics are functionally important for the cell.

Please note that I am looking for specific points that are covered in the video, so material gleaned from Wikipedia or other sources may not meet the requirements.

Discussion Topic 3. Chemosynthesis in the Giant Tubeworm. The Giant Tubeworm (Riftia pachyptila) is an animal that lives on the floor of the ocean, near hydrothermal vents that release very hot, chemical-rich water. Like all organisms Riftia pachyptila needs energy to go on living. It has a unique source of energy, and a unique way of harvesting the energy (Deep Marine Sciences, 2015; JKM12988, 2016; Kusek, 2007).

(a) Describe how Riftia pachyptila get its energy.

(b) Discuss how this relates to this week’s lessons.

References

Cox, J. F. (2015). Four minutes about ATP. . Please see “Instructor’s Insights” area for Week 3.

Deep Marine Scenes. (2013). Facts: Giant Tube Worms. [Video]. Retrieved from https://www.youtube.com/watch?v=IddCPTnmj4Q

JKM12988. (2016, December 5). Giant Tube Worms and symbiotic bacteria. [Video]. Retrieved from https://www.youtube.com/watch?v=dg6ZewBTRj8&t=6s

Johnson, R. (2014, March 5) The phytoplankton that brought Earth to life. PBS Newshour. Public Broadcasting System. Retrieved from http://video.pbs.org/video/2365193451/

Kusek, K. M. (2007, January 12). Deep-sea tubeworms get versatile ‘inside’ help. Oceanus Magazine. Retrieved from http://www.whoi.edu/oceanus/feature/deep-sea-tubeworms-get-versatile-inside-help

Read the epigenetics article you find. Continue your paper with a discussion of the epigenetics article. Be sure to paraphrase (put things in your own words) and be sure to cite the author(s) of the article you find using APA style (see the section below on using APA style). Aim for about a page for this part of your paper.

Read the epigenetics article you find. Continue your paper with a discussion of the epigenetics article. Be sure to paraphrase (put things in your own words) and be sure to cite the author(s) of the article you find using APA style (see the section below on using APA style). Aim for about a page for this part of your paper.

You will be writing a 1,000 word Reaction Paper in this course using the instructions and links found below. You will be completing the following tasks and gathering the following information for your paper:

Watch the epigenetics video from PBS. Begin your paper by defining epigenetics in your own words and discussing your reaction to the video. (Here’s an additional link if the first link is not working – https://www.dailymotion.com/video/x1luqdj)
Interview your family members and complete the Family History-Dr. Oz.pdf. Find out which disease(s) you are most at risk for.
Research and locate one article on epigenetics and whatever disease you are most at risk for (select a study on research conducted on humans) from a reputable academic source:
Reputable Sources:

journal articles
government publications based on research
Do not use:

magazines of any sort, whether they are on paper or online
Websites of any type, including epigenetics websites
Wikipedia
How to Perform Your Research

Use the College Library in person or online (log in with your new MDC ID number (the one that is all numbers). Your password is the last four digits of that same MDC ID unless you have changed it.
Read the epigenetics article you find. Continue your paper with a discussion of the epigenetics article. Be sure to paraphrase (put things in your own words) and be sure to cite the author(s) of the article you find using APA style (see the section below on using APA style). Aim for about a page for this part of your paper.

Discuss the concept of epigenesis in light of your family history and the article you read. Aim for one page for this section of your paper.
Complete the Living to 100 Questionnaires. Integrate your findings on the questionnaire into your discussion. Aim for another page.
Discuss how you can improve your health and longevity in light of your findings in this questionnaire, your understanding of epigenetics, and your knowledge of your family history. This should be your final page.
You can go over or under a page for any of the sections of the paper as long as your total paper is 1,000 words not counting the references.

General Rules for an “A” Paper (check your paper against this list)

◻ 1,000 words

◻ Original work; plagiarism free!!

◻ Double-spaced, 12-point font, 1-inch margins

◻ Covers all 6 tasks

◻ Spellchecked

◻ College-level grammar

◻ Cite your article APA style (author & year within body of paper; full reference at end)

◻ No abstract, no cover

◻ Place your name and reference number on the first page. Use page numbers.

A patient is admitted to undergo chemotherapy for cancer of the sigmoid colon that was previously treated with resection. Which code is sequenced first?

A patient is admitted to undergo chemotherapy for cancer of the sigmoid colon that was previously treated with resection. Which code is sequenced first?

Medical Coding 25 MCQ

1). A patient is admitted to undergo chemotherapy for cancer of the sigmoid colon that was previously treated with resection. Which code is sequenced first?

A. 153.3 B.153.9 C. V58.11 D. V10

2). A patient was admitted to the hospital for chest pain due to tachycardia. While in the hospital, the patient was also treated or type 1 diabetes. Upon further review, the coder noted that the documentation and EKG didn’t provide further evidence of the type of tachycardia or underlying cardiac condition(s).What should the coder report as the principal diagnosis?

A.Chest pain B.Tachycardia, NOS C.Insulin-dependent diabetes mellitus D.Cardiac disease, NOS

3). Dr. Smith recorded the following diagnoses on the patient’s discharge sheet: gastrointestinal bleeding due to acute gastritis and angiodysplasia. The principal diagnosis is coded as

A.GI bleeding. B.acute gastritis. C.angiodysplasia. D.either acute gastritis or angiodysplasia.

4. A patient was admitted with extreme fatigue and lethargy. Upon discharge, the physician documents: fatigue due to either depression or hypothyroidism. Which of the following are correct codes and sequencing for the scenario?

A. 780.79, 311, 244.9 B. 311, 249.9, 789.79 C. 249.9, 311 D. 789.79

5. Of the following, which code would take precedence over the other?

A. 072.0 over 033.0 B. 595.0 over 131.09 C. 486 over 480 D. 112.2 over 599.0

6. Upon discharge, the physician documents the following on the patient’s discharge sheet:?HIV infection. As the inpatient coder, your next step should be to

A. code the HIV infection as if it exists (according to UHDDS guidelines) and report it as the principal diagnosis.

B. review the UHDDS guidelines for assigning possible HIV infection codes versus AIDS codes.

C. query the physician and request that the statement be amended with a positive

(or negative) confirmation of the HIV infection.

D. wait to code the patient’s record until a positive finding on the serology report

confirms the HIV diagnosis.

7. For which of the following scenarios would it be appropriate to query the physician for more information before coding and/or sequencing?

A. A patient was admitted with severe abdominal pain. At discharge, the physician documents: abdominal pain due to either hiatal hernia or diverticula.

B. A patient was admitted with congestive heart failure (treated with IV furosemide) and unstable angina (treated with nitrates).

C. A patient has low potassium levels noted on the laboratory report (treated with orally administered potassium).

D. A patient is admitted with dysuria with no cause found.

8. Which of the following statements is true?

A. A patient has diabetes and an ulcer. Code the ulcer as diabetic.

B. A pregnant patient has diabetes. Code diabetes as complicating the pregnancy.

C. A patient has diabetes and cardiomyopathy. Code the cardiomyopathy as a diabetic complication.

D. A patient has diabetes and cataracts. Code diabetic cataracts.

9. A patient was admitted for metastatic carcinoma from the breast to several lymph node sites. Two years ago she had a double mastectomy. Which of the following is the correct code assignment for this case?

A. 196.8, V10.3 C. 196.8, 174.9, 85.42

B. 174.9, 196.8 D. 196.8, 174.9, V10.3

10. One of the secondary diagnoses listed on the patient’s discharge sheet is seizures. As a coder, your next step is probably

A. coding seizures to 780.39. B. coding seizures to 345.

C. not reporting the code because it’s a symptom.

D. querying the physician for more information/clarification.

11. A patient was discharged with the diagnosis of acute bronchitis with chronic obstructive asthma. Which of the following is the correctcoding and sequencing (if applicable) for this patient?

A.493.21 B. 493.21, 496 C. 466.0, 493.21 D. 493.91

12. Code 780.2 can be listed as principal diagnosis in which of the following cases?

A.For an outpatient encounter when the cause has been determined

B.For an inpatient encounter when the cause hasn’t been determined

C.When it’s listed with a contrasting diagnosis

D.It can never be listed as principal diagnosis.

13. Which of the following codes should not be listed as principal diagnosis?

A. 784.7 B.V30.00 C. E812.0 D. 307.81

14. Choose the correct code and sequencing for the following scenario: Reduction of right humerus fracture with cast.

A. 79.00 B.79.01 C. 79.00, 93.53 D. 79.01, 93.53

15. Read the following excerpt from medical record documentation and determine the correct code(s) for coding. The physician writes: “…noted burn on the arm skin with redness. Patient complained of tenderness to the touch.”

A. 943.01 B. 943.10 C. 943.21 D. 943.30

16. A patient was admitted in a coma from intentionally ingesting an entire bottle of sedatives. Which of the following is the correct coding and sequencing assignment?

A.780.01, 967.8 B. 780.01, 967.8, E950.2 C. 967.8, E950.2 D. 967.8, 780.01, E950.2

17. Which of the following situations would allow the assigning of a V code for a principal diagnosis?

A. Mother admitted for birth of infant, no complications

B. Patient admitted for dialysis

C. Patient admitted for metastatic breast cancer with a history of ovarian cancer

D. Patient admitted for poisoning has a history of alcoholism

18. A patient was admitted for nausea and vomiting due to gastroenteritis. Which of the following is thecorrect code reporting and sequencing?

A. 787.01, 787.02, 558.9 C. 558.9, 787.01

B. 787.02, 787.03, 558.9 D. 558.9

19. A physician lists positive findings on a purified protein derivative (PPD) test as a secondary diagnosis on the patient’s discharge sheet. How should this listing be coded?

A. 795.51 B. 010.95 C. 011.05 D. This listing shouldn’t be coded.

20. A physician lists urosepsis as a secondary diagnosis on a patient’s discharge sheet. How would you code this diagnosis?

A. Code it to 790.7. C. Code it to 599.0.

B. Code it to 038.9. D. Code 599.0, 038.9.

21. A patient is admitted for metastatic adenocarcinoma of the sacrum from the prostate. A prostatectomy was performed 11 months ago. Which of the following should be reported as the principal diagnosis for this patient?

A. V10 B. 185 C. 198.5 D. 170.6

22. A patient was discharged with a diagnosis of diabetes with nephropathy and chronic renal failure. How many codes would be reported for this patient?

A. One B. Two C. Three D. Need more information on the type of diabetes

23. If the physician describes the patient as presently in a manic phase, but has experienced depression in the past, this condition may be coded as

A. 296.4X B. 296.5X C. 296.6X D. Need more information

24. Codes 331.9, 332.0, are conditions affecting the

A. central nervous system. C. gastrointestinal system.

B. peripheral nervous system. D. cardiovascular system.

25. A patient was admitted with an acute exacerbation of chronic obstructive bronchitis and found to be in respiratory failure. Which of the following is the correct coding and sequencing for this case?

A. 518.81, 491.21 B. 491.21, 518.81 C. 518.81, 496 D. 493.91, 496, 518.81

U Can Also Purchase Other assignment for this Course ( Just Click On Below Link )

Medical Coding Level I (10 MCQ)

http://www.homeworkmarket.com/content/medical-coding-level-i-medical-coding-level-i

Medical Coding Level II

http://www.homeworkmarket.com/content/medical-coding-level-ii

Medical coding and Billing

http://www.homeworkmarket.com/content/medical-coding-and-billing-medical-coding-and-billing-mcq

Medical Coding Quiz 10 MCQ

http://www.homeworkmarket.com/content/medical-coding-quiz-10-mcq-medical-coding-quiz-10-mcq