The maintenance of homeostasis is of major importance to all organ systems in the body and the overall survival of the individual. Explain how homeostasis is the maintenance of a dynamic range of environmental qualities rather than holding the internal environment at a set point. What would be wrong with a set point (say for body temperature) rather than a working range of temperatures?

.

The maintenance of homeostasis is of major importance to all organ systems in the body and the overall survival of the individual. Explain how homeostasis is the maintenance of a dynamic range of environmental qualities rather than holding the internal environment at a set point. What would be wrong with a set point (say for body temperature) rather than a working range of temperatures?

The endocrine system is closely tied to homeostasis functioning. Give two examples of hormones (including their glands of origin and action) that play major roles in homeostatic processes in the body. What happens if these hormones are disrupted in their actions?

Also, look at how we adapt to survival in the outside world. Discuss how maintaining homeostasis gives us greater freedom of activity from dependence upon changes in the external environment. What happens during extremes that force our bodies out of homeostatic bounds? Give specific examples.

Why is the maintenance of homeostasis especially important during development of new humans within the bodies of their mothers? What can go wrong if specific homeostatic functions are disrupted?

MUST BE 1500 WORDS

APA FORMATTED

MUST HAVE REFERENCES

MUST CITE

What is the diagnosis? Explain the reason behind floaters and dark areas in the visual field. How should the doctor treat Mr. Ally?

What is the diagnosis?
Explain the reason behind floaters and dark areas in the visual field.
How should the doctor treat Mr. Ally?

Ophthalmic Disorders

Mr. Ally went to the eye doctor and complained about dark areas in his vision. He had never noticed it before. There is no pain.

What is the diagnosis?
Explain the reason behind floaters and dark areas in the visual field.
How should the doctor treat Mr. Ally?

As compared to the US Constitution, why is the Texas Constitution so frequently amended?

As compared to the US Constitution, why is the Texas Constitution so frequently amended?
How does the turnout for elections dealing with constitutional amendments compare to turnout for presidential elections?
Do you think the level of turnout influences the legitimacy of the amendments that are passed or rejected?
Is Proposition 2 a violation of the equal protection clause of the U.S. Constitution?
Should Proposition 2 be deleted from the Texas Constitution? Why or why not?
Must the state recognize same-sex marriages that have been licensed and performed lawfully in another state? If so, why? If not, why not?
Do you believe that religious freedom gives people the right to deny their services for same-sex marriages? If so, why? If not, why not?

In October of 2003, a raging wildfire swept through the mountain ecosystems in Southern California, burning everything in its path to the ground and driving away all of the animals. In order for the mountain ecosystem to establish itself, which member of the food web has to return first?

In October of 2003, a raging wildfire swept through the mountain ecosystems in Southern California, burning everything in its path to the ground and driving away all of the animals. In order for the mountain ecosystem to establish itself, which member of the food web has to return first?

FINAL EXAMINATION

Please copy and paste the final examination into a Word file. Complete it in this form (do not make any structural changes!) and submit it as an attachment into your Assignment Folder. Do not forget to put your name on top of the exam!

The absolute deadline for submission is Sunday, March 8, NOON.

I cannot accept any later submissions.

YOUR NAME:

_______________________________________________________________

Total possible points: 100

I. Multiple choice questions. Please bold or underline the correct answer (1point each=50 points)

1. In October of 2003, a raging wildfire swept through the mountain ecosystems in Southern California, burning everything in its path to the ground and driving away all of the animals. In order for the mountain ecosystem to establish itself, which member of the food web has to return first?

Deer
Coyotes
Snake
Grasses

2. Suppose you conduct an experiment which simulates glacial recession over time. What is the dependent variable in this experiment?

Glacial mass
Sunlight
The season
Time

3. How many dependent variables can be tested during any single experiment?

4
3
2
1

4. The effectiveness of a medication containing growth hormones is tested on a group of young male rabbits 3 weeks of age. The best control group would be:

Any group of rabbits
A group of male rabbits, three weeks old, not given the medication
A group of female rabbits, three weeks old, not given the medication
A mixed group of male/female rabbits, three weeks old, not given the medication
No control is required; just measure whether the rabbits grew

5. When writing a lab report or a research paper, you need to show what the difference is between the “Results” section and the ”Discussion” section. Which of the following is correct?

The Discussion analyzes data, whereas the Results analyzes the procedure.
The Discussion analyzes data, whereas the Results displays data.
The Discussion displays data, whereas the Results analyzes the Discussion.
The Discussion displays the procedure, whereas the Results analyzes the data.

6. What characteristic of carbon makes it a good backbone for creating diverse and durable molecules?

Carbon is a large atom
Carbon forms four covalent bonds
Carbon forms hydrogen bonds
All of the above

7. Which of the following reactions or pathways is catabolic?

Converting glucose to carbon dioxide and water (cellular respiration)
Making starch from many glucose monomers
Photosynthesis, which builds glucose from carbon dioxide using energy from light
Making ATP from ADP and phosphate

8. One human disease is caused by a change in the DNA from GAA to GUA. This change is an example of:

Crossing-over
A meiosis error
A mitosis error
A mutation

9. What subatomic particles are found in the nucleus?

Elecctrons
Protons
Neutrons
Protons and neutrons
Protons and electrons

10. Which of the following describes H20, NaCl, CO2, and HCl?

All are acids
All are gases
All are salts
All are inorganic molecules

11. Which of the following correctly describes a buffer?

A buffer converts an alkaline solution to neutral
A buffer converts an acid solution to neutral.
A buffer converts alkaline solutions to acid solutions.
A buffer converts strong bases or acids to weak bases or acids.

12. Which term does not belong in this list?

Acid
Vinegar
Hydrogen ion donor
pH 8
Lactic acid

13. The process in which molecules spread randomly from areas of higher concentration to areas of lower concentration is:

Filtration
Diffusion
Exocytosis
Osmosis

14. Organize the following solutions from most concentrated to least concentrated: hypertonic, hypotonic, and isotonic.

Hypotonic>Hypertonic>Isotonic
Hypertonic>Hypotonic>Isotonic
Hypertonic>Isotonic>Hypotonic
Isotonic>Hypotonic>Hypertonic

15. The rate of diffusion depends on which of the following?

The medium
The size of the molecule
The polarity
All of the above
A. and C. only

16. All of the following are examples of elements except

Oxygen
Water
Hydrogen
Carbon

17. What would happen to a eukaryotic cell, if too much osmotic pressure develops within a cell?

The cell would remain the same size, but the internal organelles would become dehydrated
The cell would decrease in size, and could collapse.
The cell would increase in size, and could lyse.
Nothing, osmotic pressure does not impact the cell.

18. Inthe following chemical reaction, what is carbon dioxide (CO2)?

12 H20 + 6 CO2 = 1 glucose molecule + 6 O2

A. substrate

B. product

C. enzyme

D. activation factor

E. independent variable

19. The bond in which two atoms share one or more pairs of electrons is a_________ bond.

Polar
Hydrogen
Ionic
Covalent

20. Which of the following terms includes all of the chemical reactions that occur within a cell?

Cellular respiration
Catabolism
Redox reactions
Metabolism
Phosphorylation

21. Within a cell, energy released by electrons is often used to phosphorylate which of the following molecules?

ADP
ATP
Pyruvate ions
Oxygen
NAD

22. All of the following apply to glycolysis except

Occurs without oxygen
Degrades glucose to H2O and CO2
Ends with formation of pyruvic acid
Occurs during fermentation

23. In which of the phases of cellular respiration is the majority of ATP formed?

Processing of pyruvic acid for the Krebs cycle
Electron transport chain
Glycolysis
The Krebs cycle
All phases produce the same number of ATP molecules

24. The energy of the sun is converted into usable energy for the cell in the form of _________.

ADP
ATP
Glucose
CO2

25. The starting materials of photosynthesis are _____________

Oxygen and glucose
Carbon dioxide and oxygen
Carbon dioxide and water
Oxygen and water

26. What type of macro-molecule is frequently an enzyme?

Carbohydrate
Nucleic acid
Lipid
Protein

27. What function do enzymes perform?

Increase substrate concentration
Increase the temperature
Increase the activation energy required for a reaction to occur
Decrease the activation energy required for a reaction to occur

28. The most important aspect of cellular respiration is that ___________________

It is the process that occurs only in animal cells
It is the process that utilizes fat as its primary energy source
It is the process that enables living organisms to utilize the energy stored in glucose
It is the only cellular process that yields ATP

29. The statement best describes the relationship between plants and animals on earth is

Plants produce O2 and sugars from CO2
Animals produce CO2 and H2O from sugars and O2
Plants produce O2 and sugars and animals produce CO2 and H2O
Animals produce O2 and sugars and plants produce CO2 and H2O

30. What is the function of the ribosome?

Digestion
RNA duplication
Mobility
Protein synthesis

31. What is the function of the lysosome?

Prokaryotic digestion
Eukaryotic digestion
Prokaryotic mobility
Eukaryotic mobility

32. In what stage of the cell cycle is genetic content replicated?

Interphase
Prophase
Metaphase
Anaphase
Telophase

33. How many chromatids comprise a duplicated chromosome?

One
Two
Three
Four

34. Which of the following could not be a sequence of RNA?

GCGUUU
UAUGCG
ATGCGT
AUGCGU
AAACUG

35. The product of meiosis includes which of the following?

Haploid cells
Genetically unique cells
Four daughter cells
All of the above
A. and C. only

36. Often referred to as the Central Dogma, identify the traditional sequence of protein synthesis.

DNA->RNA->Protein
RNA->DNA->Protein
Protein->RNA->DNA
Protein->DNA->RNA

37. In humans, the allele for dimples (D) is dominant. The allele for not having dimples (d) is recessive. If a woman (DD) and a man (Dd) have four children, how many of the children will not have dimples?

0
1
2
3
4

38. Which of the following variations could be subject to natural selection?

A dog with short legs due to malnutrition is able to crawl into holes better than his litter mates.
A tree is not infested by a ground-dwelloing beetle when the homeowener cuts the lower branches.
A hyena is born with a spotted fur pattern that allows it to hide in the grass better than his litter mates.
A pigeon learns that’s when its keeper comes near, it will be fed.
All of these variations may be acted on by natural selection.

39. What do plants and animals have in common?

They are both heterotrophic
They are both autotrophic
They are both prokaryotic
They are both eukaryotic
They are both hydrophobic

40. Which of the following is not a characteristic of fungi?

Cells have cell walls
Photosynthetic
Include single-celled and filamentous forms
Can use a wide variety of nutrient

41. Microevolution is defined as:

Changes in population size
Changes in the frequency of alleles in the gene pool
Changes in the composition of the population
Emergence of new species
Changes in community size

42. A zorse is the offspring produced through interbreeding between a horse and a zebra. Zorses are often preferred for riding because of their physical shape, but they are sterile. According to Linnaean taxonomy, are zebras and horses classified in the same species?

Yes
No
Sometimes
Not enough information to determine

43. Red rose color is incompletely dominant over white rose color. If a red rose is crossed with a pink rose, what percentage of the offspring will be pink?

100
75
50
25

44. Honey bees engage in entomophily, pollination through pollen distribution, as part of the process to produce honey. What is entomophily an example of?

Ecosystem
Niche
Community
Habitat

45. Themajority of climate scientists suggest that the current change in climate is caused predominantly by ________.

An enhancement of the greenhouse effect
A decreased reliance on fossil fuels for energy
A thinning of the ozone layer
A melting of the polar ice caps
An increase in solar radiation

46. Which of the following is not an expected effect of global climate change?

A rise in the sea levels
Flooding of coastal cities
Decrease in the size of glaciers and ice sheets
Increase in the size of glacier and ice sheets
More extreme weather

47. If a wolf eats a rodent which ate a small insect which ate a plant, the wolf would be a(n)

Autotroph
Primary producer
Primary consumer
Secondary consumer
Tertiary consumer

48. The organisms that represent the different species within an ecosystem that interact in various ways, comprise a _______________

Population
Trophic level
Species
Community
Habitat

49. Inheritable mutations, which may allow a population to evolve, are produced

As a response to selection pressure
By chance
By natural selection
As a response to environmental pressure
By artificial selection

50. The ability of fireflies and angler fish to produce light is an example of convergent evolution. What can you conclude about these two animals based on this information?

They share a recent common ancestor
The ability to produce light is an ancient trait
They are found in the same location
They are both adapted to environments which are low in light
All of the above

II. Matching of definitions and terms. Please place the correct number in front of each definition. (1 point each = 10 points):

____ DNA with attached proteins

____ A haploid cell that combines with another haploid cell during fertilization

____ Converts light energy to chemical energy stored in the chemical bonds of glucose or

starch

____ A specific portion of a chromosome that contains information for a particular inherited

trait

____ An interaction during meiosis in which chromatids exchange segments; it results in genetic

recombination

____ Nucleotide that drives most energy-requiring metabolic reaction

____ Extracts energy stored in carbohydrates; synthesizes ATP; produces water and carbon

dioxide

____ The process in which ribosomes synthesize proteins using the mRNA transcript

____ The synthesis of mRNA from a DNA template

____ Are primary cellular structures (or components) where proteins are assembled

1. ATP

2. chromosome

3. crossing over

4. chloroplast

5. gamete

6. DNA molecules

7. gene

8. germ cell

9. meiosis

10. central vacuoles

11. lysosomes

12. mitochondrion

13. mitosis

14. translation

15. transcription

16. ribosomes

17. microtubules

18. Golgi bodies

19. RNA molecules

20. nucleoli

III. True-False questions. (1 point each = 5 points):

1. Diffusion will occur, if a concentration gradient exists.

True
False

2. When a founder population has a small gene pool, evolutionary change is more likely to be rapid than if the founder population has a large gene pool.

True
False

3. Stabilizing selection is a pattern of natural selection that favors an average, not extreme, expression of a trait.

True
False

4. Once an adaptive feature appears, it remains in all the descendant unless the species becomes extinct.

True
False

5. Humans are more likely to be infected by viruses after the viruses had a chance to multiply outside the body on surfaces touched by infected people.

True
False

IV. Matching of Terms/Concepts with Definitions/Associations. Place the correct number on the line behind each term. (1/2 point each=5 points)

Term or Concept

Water molecule ___

Carbon ___

Homeostasis ___

Ionic Bonding ___

Covalent Bonding ___

Carbohydrate ___

Enzyme ___

Acid ___

Base ___

Lipid ___

Definition/Association

1. energy source

2. two atoms sharing electrons

3. electron donated/received

4. hydrophobic

5. element found in all living organisms

6. catalyst

7. OH- > H+

8. polar

9. characteristic of all living organisms

10. H+ > OH-

V. Brief essay questions: Please write a concise and succinct response to each one of the following questions; be sure to mark your answers with the correct essay number. I am looking for clarity and detail which reflects your knowledge of the subject. Always include appropriate examples, if warranted. (Total possible points=30)

1. The habitat of one species of tropical fish is red coral reefs. The large majority of the fish in this populations are red. A few individual fish carry a mutation that prevents the production of the red pigment; as a result, these fish are white. The temperature of the ocean where these fish live becomes warmer and warmer over a ten year period, and, as a result, the coral is bleached and turns white. Use what you have learned about natural selection to explain how this bleaching event may have affected the evolution of this fish population (not including possible direct effects of warmer temperatures for the fish). Include the following terms in your explanation: Differential reproduction, beneficial trait, allele frequency, selection pressure, evolution (5 possible points)

2. You scoop up a water sample from a local pond nearby, because you are curious about the possible microbes that might live there. After looking at several slides that held drops of the sample, you noticed two different kinds of cells: One kind was very small and had no separate internal structures; the other kind was much larger, and it contained several kinds of internal structures that were physically different from each other. Please name each cell and briefly describe their overall similarities and differences. (5 possible points)

3. Humans share 99% of their genes with chimpanzees, 90% with mice, 50% with fruit flies, and 37% with celery. Please explain the evolutionary significance of these data. Phylogenetic details here are essential. (5 possible points)

4. A population of pygmy-deer becomes re-established on an island after having been absent for a very long time. They are given ‘protective status’, and flourish in numbers. Then an unusually long and harsh winter happens. The deer are seen eating bark, raiding bird feeders, and some die. Describe both the density-dependent and density independent factors at work here, and explain what might be happening to this population. Terms such as carrying capacity, and birth and death rates must be part of your discussion. (5 possible points)

5. When a rabbit eats the lettuce in your garden, all of the energy in the lettuce is used by the rabbit. Is this statement true or false? Defend your answer. Your answer must be detailed about energy conversions and trophic levels. (5 possible points)

6. Before recombinant products were available, humans who needed hormones or other biological products, such as insulin, had to use products that were harvested from other humans and non-human animals. Can you think of specific health risks that might be associated with products that were not made with genetically engineered bacteria? (5 possible points)

Which DNA strand is used in the production of mRNA and why? Why does the gene need a promoter and a “start”?

Which DNA strand is used in the production of mRNA and why?
Why does the gene need a promoter and a “start”?

In your paper, address the following points:

You will get to simulate transcription and translation by building a sentence “polypeptide” from words “amino acids”. You need review the genetic code and the roles of the mRNA, tRNA and the ribosome in the process of translation. Using this knowledge be prepared to discuss the following scenario:
Here is the gene of interest:
GTAACCGTATTGCAGCTATTAGCAGCCATG
CATTGGCATAACGTCGATAATCGTCGGTAC

Which DNA strand is used in the production of mRNA and why?
Why does the gene need a promoter and a “start”?
Analyze how the ribosome, tRNA and mRNA work together to fit all of the pieces of this puzzle together to make a protein.
Translate the sequence about to make a protein.
What would happen if a frame shift mutation happened in the sequence above? Specifically, what occurs if you were to add a G after the third nucleotide in the sequence? How does this impact the function of the protein in the cell?
Explain why an insertion of three nucleotides is less likely to result in a deleterious effect than an insertion of a single nucleotide.
5 years ago

What is genetic transformation? 2) which plate should have no growth and why? 3) what did our plasmid carry?

1) What is genetic transformation?

2) which plate should have no growth and why?

3) what did our plasmid carry?

4) why did a plate contain arabinose?

5) why did we add LB broth?

6) what does CaCl2 do?

7) why did we heat shock the bacteria?

8) what does sodium citrate do?

9) what does SDS do?

10) why did we add alcohol to the tube for extraction?

11) what is the wild-type color of the colonies? what is the transformed color?